Bienes con certificado en trámite

Listado de bienes para la verificación de ausencia de producción nacional.

Producto Descripción Cantidad Rubro Moneda Valor FOB Valor CIF Inicio publicación PDF
HORNO HORNO CD1ERRA. P/N 0008407, marca RATIONAL iCombi Pro 10-1/1, 3 AC440 V 50/60Hz Eléctrico LM100DE.AXXXX MarineLine. Incluye: Ducha con manguera retráctil, Bastidor colgante Versión para buques USPHS, Interface Ethernet y USB, 3(tres) P/N 60.71.617 Bandeja para plancha y parrilla 1/1 GN, con revestimiento Trilax, 4(cuatro) P/N 6014.1110 Contenedores, 1/1 GN, 100 mm profundidad con esmalte de granito, 3(tres) P/N 6013.1106 Contenedores, 1/1 GN, 65 mm profundidad acero inoxidable, y todos los elementos para su normal funcionamiento. 1 Bienes de uso Euro 10953,1 09-11-2020
PARTES Y ARTICULOS PARA RADARES 22 ITEMS Componentes para reemplazo de partes que presentan fallas de tipo mecánico, eléctrico y electrónico. Todas son críticas para mantener a los radares en operación continua. Ver listado adjunto 93 Repuestos y accesorios Euro 18329.20 19-11-2020
1 gallon of CEO2AC-30 1 gallon of CEO2AC-30 1 De laboratorio Dólar 306,50 19-11-2020
PCR Plate Heat Seal, clear, optical Nro Catálogo: 1814030 3 De laboratorio Dólar 302,04 19-11-2020
Certified Low Range Ultra Agarose Nro Catálogo: 1613107 2 De laboratorio Dólar 1023,54 19-11-2020
Ss Advanced Mix Universal con Sybr Green, 500 x 20ul, 5ml Nro Catálogo: 1725271 6 De laboratorio Dólar 656,28 19-11-2020
EZ Load 100bp Molecular Ruler Nro Catálogo: 1708352 3 De laboratorio Dólar 447,39 19-11-2020
Material de Laboratorio Se trata de una Válvula de alivio para Büchi B90 / B-90 HP (11055829), una Tobera de 2 fluidos para Büchi B-290 (044698) y un Kit para conversión de tobera a 3 fluidos (046556) 1 De laboratorio Otros 2731,00 2870,00 19-11-2020
Material de Laboratorio Se trata de un Set de O-rings (044759) 1 De laboratorio Otros 19-11-2020
Spectrometro FT-IR marca Thermo Scientific, modelo $28,789.00 Nicolet IS 20 y accesorios Spectrometro FT-IR marca Thermo Scientific, modelo $28,789.00 Nicolet IS 20 y accesorios 1 De laboratorio Dólar 28789.00 19-11-2020
Oligonucleotides 1 Synthetic Oligonucleotide (DNA) Barcode: 028154162; Oligonucleotide Sequence: E1A Dir: 5’CATGGGTCCCGAGGTGATCGACCTGACCTGCCACGAGGCCGGCTTCCCCCCCAGCTGATAAG3’; Molecular Weight: 19002 g/mol; Quantity:10.9nmol; Volume: 109µl; Oligonucleotide %GC: 66,1%;. Synthesis scale: 0.05 µmol; Purification: HPSF. Oligonucleotide Name/Label: E1A dir. 25 De laboratorio Dólar 50 60 19-11-2020
ESPECTROFOTOMETRO INFRARROJO DE USO EN LABORATORIO Part 206-30000-58 Espectrofotometro infrarrojo FTIR, Modelo IRT Tracer-1000 completo compuesto por: PART 206-30201-92 Software labSolutions; Part 206-74253-58 Kit infrarrojo cercano; Part 206-74250-41 Kit Beam Switching Marca Shimadzu con Detector MCT de banda angosta Part 155-1018R Módulo de muestro Modelo ESR-R; part 155-2030 Detector MCT de banda angosta; Part 913-0959 Adaptador para intercambiar acc Veemax II; Part 013-1118 Base óptica para FTIR IRT; part 013-3360 Accesorio de alineación; Part 013-3372 Base de Peek para celda electroquímica; Part 160-5552 Cristal de Si de 60º; Part 160-5527 Cristl de CaF2; Part 162-4742 Plato superior VeeMax III para celda y Part 162-4756 Kit adaptador J1. Marca: Pike 1 Bienes de uso Dólar 48520,95 49920,95 19-11-2020
EQUIPO DE DETERMINACION DE OLORES Part NR0001 Olfatómetro de campo nasal ranger, incluye: Olftactómetro de campo, 2 cartuchos filtrantes , 1 máscara nasal, 1 correa para el hombro, bolsa de transporte, 10 sellos confort, 10 máscara, 4 juntas tóricas de máscara, 1 cepillo de barril; Cod NR0011, kit de prueba de sensibilidad a los olores; Cod NR0081, Cartucho de filtro de olores universal Tipo I; Part NR0091 Caja de 6 pares de Filtro universal; Part NR0054 Dial de disoluciones alto D / T y Pieza NR0062, Paquete de 10 Sello Confort de olores. Marca: St Croix Sensory, Inc 1 Bienes de uso Dólar 3685,00 4272,50 19-11-2020
Controlador 45431 CONTADOR PROPORCIONAL 1 De laboratorio Dólar 1375.50 1550.50 19-11-2020
Equipo Equipo de ataque por Plasma arca DIENER TIPO ZEPTO Modelo 1 s/timmer s/Pirani 13,56 Mhz compuesto por: 1. Unidad basica tipo A con control manual 1 Valvua de gas 1 Conexion Plasma ZEPTO 23V 16A 1 Camara de vacio 1 Electrodo Std 1 Generador 13,56 MHz 1 Bomba de vacio Anest Scrollvac ISP-90 1 tRAY 1 De laboratorio Dólar 11000 11699 19-11-2020
CHIPS DE ALUMINO Frasco con chips de alumino de 15.6x0,45mm 1 Repuestos y accesorios Dólar 117.6 117.6 19-11-2020
Carcasas de Cinc Caja de 1000 unidades de carcasas de Cinc, celdas botón CR2032 1 Repuestos y accesorios Dólar 390 390 19-11-2020
Equipo de detección fallas Equipo de testeo de baterías 5V10mA 2 Bienes de uso Dólar 1783.6 2763.6 19-11-2020
Agata 1 Bolsa de bolas de ágata de 20mm y 1 Bolsa con bolas de agata de 10mm 2 Repuestos y accesorios Dólar 53.90 53.90 19-11-2020
Mortero de uso en laboratorio Mortero de ágata de 70mm 2 Repuestos y accesorios Dólar 156.8 156.8 19-11-2020
Fluorómetro de uso en laboratorio Medidor de flujo. 1 Repuestos y accesorios Dólar 137.2 137.2 19-11-2020
Malla de carbon Malla de carbón de 20cm c20cm 2 Repuestos y accesorios Dólar 109.76 109.76 19-11-2020
Fibra de vidrio Caja de 25 unid de Papel de fibra de vidrio de 90mm de diamétro 1 Repuestos y accesorios Dólar 135.24 135.24 19-11-2020
Ultrasonic Homogenizer (Sonicador) LUHS-A11 1 De laboratorio Dólar 2130 19-11-2020
CENTRIFUGA DE USO EN LABORATORIO Cat 75004260, Centrifuga de laboratorio refrigerada, Modelo Legend X1 R completa compuesto por: Cat 75003181, Rotor oscilante Modelo TX-400 con Set de 4 buckets redondos; Set de 4 tapas selladas; Set de 4 adaptadores para tubods de 250ml; Set de 4 adaptadores para 16 tubos de 50ml; Set de 4 adaptadores para 36 tubos de 15ml y Set de 4 adaptadores para 132 tubos de 1,5/2ml. Cat 75003620 Rotor de aluminio de ángulo fijo Modelo HighConic II con Set de 6 adaptadores de 6 tubos de 50ml, Set de 6 adaptadores para 6 tubos de 15ml; Set tubo Nalgene Oak Ridge de 85ml; Cat 75005719, 1 Rotor sellado de aluminio de ángulo fijo, Modelo MicroClick30x2 con Set de 24 adaptadores para tubos 0,5ml, Set de 24 adaptadores para tubos de 0,25ml, Set de 24 adaptadores para tubos de PCR de 0,2ml y Cat 75003624 1 Rotor oscilante para microplacas Modelo M-20 con 2 Buckets y 2 adaptadores para microplacas. Marca: Thermo Scientific-Sorvall 1 Bienes de uso Dólar ---------- 15900,00 19-11-2020
SC1010 Gene synthesis:Igsf3 Length: 1068bp SC1010 Gene synthesis:Igsf3 Length: 1068bp 1 Química general Dólar 373.8 19-11-2020
SC1692 VectorArk Cloning:U6 sguide IGSF3 x3 - CAG RFP VectorArk Vector: CAG- RFP Cloning method: CloneEZ Delivery: Standard 4 µg free of charge (1 µg for low-copy plasmid) Delivery form: Freeze dried SC1692 VectorArk Cloning:U6 sguide IGSF3 x3 - CAG RFP VectorArk Vector: CAG- RFP Cloning method: CloneEZ Delivery: Standard 4 µg free of charge (1 µg for low-copy plasmid) Delivery form: Freeze dried 1 Química general Dólar 49 19-11-2020
SC1441 Express Mutagenesis:U6 sguide NL2 x3 - CAG RFP Target Insert Name: Nlgn2 Delivery: Standard 4 µg free of charge (1 µg for low-copy plasmid), Freeze dried SC1441 Express Mutagenesis:U6 sguide NL2 x3 - CAG RFP Target Insert Name: Nlgn2 Delivery: Standard 4 µg free of charge (1 µg for low-copy plasmid), Freeze dried 1 Química general Dólar 297 19-11-2020
SC1441 Express Mutagenesis:U6 sguide Neun x3 - CAG RFP Target Insert Name: Neun Delivery: Standard 4 µg free of charge (1 µg for low-copy plasmid), Freeze dried SC1441 Express Mutagenesis:U6 sguide Neun x3 - CAG RFP Target Insert Name: Neun Delivery: Standard 4 µg free of charge (1 µg for low-copy plasmid), Freeze dried 1 Química general Dólar 297 19-11-2020
S362E Site Master, 2 MHz to 6 GHz Cable & Antenna Analyzer, 100 kHz to 6 GHz Spectrum Analyzer. 1 De laboratorio Dólar 12.952,03 13.282,03 19-11-2020
15RNFN50-1.5-R Test Port Extension Cable, Armored, with Reinforced Grip, 1.5 meters, N(m) - N(f), 6 GHz, 50 O. 1 De laboratorio Dólar 520,70 720,70 19-11-2020
OSLN50A-8 Coaxial Calibration Kit, Type N(m), DC to 8 GHz, 50 O 1 De laboratorio Dólar 646,81 846,81 19-11-2020
BML-NS105-0025 Clozapine N-oxide, =99% (HPLC). 25mg. 3 Química general Dólar 1095 1260 19-11-2020
DETECTOR EVAPORATIVO DE USO EN LABORATORIO Part 228-45115-38 Detector evaporativo de masas, Modelo ELSD-LT II completo: Incluye Part 228-45528-91 Regulador de gas con filtro; Part 228-45528-02 Filtro regulador de gas.Marca: Shimadzu 1 Bienes de uso Dólar 31513,35 19-11-2020
GENERADOR DE NITROGENO Part NP-65-0001 Generador de nitrógeno, Modelo Solaris 10 para uso en detector completo compuesto por: Part 65-0003 Compresosa de aire; Part 08-9013 Kit de service y Part 08-9454 Kit de mantenimiento. Marca: Peak Scientific 1 Bienes de uso Dólar 14805,29 19-11-2020
Anticuerpo ACC-029 Anti-rat TRPV1 (extracellular) 1 Anticuerpos Dólar 560,00 0.00 19-11-2020

Contacto

Dirección: Godoy Cruz 2320, 2º piso
Código postal: C1425FQD
Teléfono: (54-11) 4899-5000 int. 2082/2084/2086/2088/2090/2092/2094
Correo electrónico: info_roecyt@mincyt.gob.ar

Redes sociales del área